TY - JOUR
T1 - Corrigendum to “TRPC3 channels critically regulate hippocampal excitability and contextual fear memory” (Behavioural Brain Research (2015) 281 (69–77) (S0166432814008122) (10.1016/j.bbr.2014.12.018))
AU - Neuner, Sarah M.
AU - Wilmott, Lynda A.
AU - Hope, Kevin A.
AU - Hoffmann, Brian
AU - Chong, Jayhong A.
AU - Abramowitz, Joel
AU - Birnbaumer, Lutz
AU - O'Connell, Kristen
AU - Tryba, Andrew K.
AU - Greene, Andrew S.
AU - Chan, C. Savio
AU - Kaczorowski, Catherine C.
N1 - Publisher Copyright:
© 2017
Copyright:
Copyright 2019 Elsevier B.V., All rights reserved.
PY - 2017/8/14
Y1 - 2017/8/14
N2 - The authors regret that numerical errors occurred in the 4th paragraph of the results section. Specifically, in the following sentences, where the corrections have been underlined: • (Fig. 3A: FC memory index; 55.6 ± 4.79% freezing, n = 7 mice)• …as well as naïve untrained controls (n = 7 mice)• [Fig. 3B: one-way ANOVA F(2,21) = 4.6, p = 0.02 (one-tailed) with post-hoc tests comparing FC relative to ISD (p = 0.004) and naïve cage controls (p = 0.05)]The authors have revised Fig. 3 caption to reflect these above changes; specifically, in the following sentences, where the corrections have been underlined: • (A) …(memory index; 55.6 ± 4.79% freezing, n = 7 mice)• (B) …(Cntl; n = 7 mice) and ISD controls [One-way ANOVA F(2,21) = 4.6, p = 0.02 with post-hoc tests comparing FC relative to ISD (p = 0.004) and naïve cage controls (p = 0.05)]• Additionally, the authors have revised the corresponding figure (Fig. 3A & B) to reflect these changes.In addition, a nucleotide was omitted from the sequence of mTrpC3 shRNA in the methods section of the manuscript. The sequence of mTrpC3 shRNA is GAGGUUCAAUAUUUCACCUAUGC The authors would like to apologise for any inconvenience caused.
AB - The authors regret that numerical errors occurred in the 4th paragraph of the results section. Specifically, in the following sentences, where the corrections have been underlined: • (Fig. 3A: FC memory index; 55.6 ± 4.79% freezing, n = 7 mice)• …as well as naïve untrained controls (n = 7 mice)• [Fig. 3B: one-way ANOVA F(2,21) = 4.6, p = 0.02 (one-tailed) with post-hoc tests comparing FC relative to ISD (p = 0.004) and naïve cage controls (p = 0.05)]The authors have revised Fig. 3 caption to reflect these above changes; specifically, in the following sentences, where the corrections have been underlined: • (A) …(memory index; 55.6 ± 4.79% freezing, n = 7 mice)• (B) …(Cntl; n = 7 mice) and ISD controls [One-way ANOVA F(2,21) = 4.6, p = 0.02 with post-hoc tests comparing FC relative to ISD (p = 0.004) and naïve cage controls (p = 0.05)]• Additionally, the authors have revised the corresponding figure (Fig. 3A & B) to reflect these changes.In addition, a nucleotide was omitted from the sequence of mTrpC3 shRNA in the methods section of the manuscript. The sequence of mTrpC3 shRNA is GAGGUUCAAUAUUUCACCUAUGC The authors would like to apologise for any inconvenience caused.
UR - http://www.scopus.com/inward/record.url?scp=85019739323&partnerID=8YFLogxK
UR - http://www.scopus.com/inward/citedby.url?scp=85019739323&partnerID=8YFLogxK
U2 - 10.1016/j.bbr.2017.05.038
DO - 10.1016/j.bbr.2017.05.038
M3 - Comment/debate
C2 - 28576459
AN - SCOPUS:85019739323
VL - 332
SP - 379
JO - Behavioural Brain Research
JF - Behavioural Brain Research
SN - 0166-4328
ER -