Corrigendum to “TRPC3 channels critically regulate hippocampal excitability and contextual fear memory” (Behavioural Brain Research (2015) 281 (69–77) (S0166432814008122) (10.1016/j.bbr.2014.12.018))

Sarah M. Neuner, Lynda A. Wilmott, Kevin A. Hope, Brian Hoffmann, Jayhong A. Chong, Joel Abramowitz, Lutz Birnbaumer, Kristen O'Connell, Andrew K. Tryba, Andrew S. Greene, C. Savio Chan, Catherine C. Kaczorowski*

*Corresponding author for this work

Research output: Contribution to journalComment/debatepeer-review

Abstract

The authors regret that numerical errors occurred in the 4th paragraph of the results section. Specifically, in the following sentences, where the corrections have been underlined: • (Fig. 3A: FC memory index; 55.6 ± 4.79% freezing, n = 7 mice)• …as well as naïve untrained controls (n = 7 mice)• [Fig. 3B: one-way ANOVA F(2,21) = 4.6, p = 0.02 (one-tailed) with post-hoc tests comparing FC relative to ISD (p = 0.004) and naïve cage controls (p = 0.05)]The authors have revised Fig. 3 caption to reflect these above changes; specifically, in the following sentences, where the corrections have been underlined: • (A) …(memory index; 55.6 ± 4.79% freezing, n = 7 mice)• (B) …(Cntl; n = 7 mice) and ISD controls [One-way ANOVA F(2,21) = 4.6, p = 0.02 with post-hoc tests comparing FC relative to ISD (p = 0.004) and naïve cage controls (p = 0.05)]• Additionally, the authors have revised the corresponding figure (Fig. 3A & B) to reflect these changes.In addition, a nucleotide was omitted from the sequence of mTrpC3 shRNA in the methods section of the manuscript. The sequence of mTrpC3 shRNA is GAGGUUCAAUAUUUCACCUAUGC The authors would like to apologise for any inconvenience caused.

Original languageEnglish (US)
Pages (from-to)379
Number of pages1
JournalBehavioural Brain Research
Volume332
DOIs
StatePublished - Aug 14 2017

ASJC Scopus subject areas

  • Behavioral Neuroscience

Fingerprint Dive into the research topics of 'Corrigendum to “TRPC3 channels critically regulate hippocampal excitability and contextual fear memory” (Behavioural Brain Research (2015) 281 (69–77) (S0166432814008122) (10.1016/j.bbr.2014.12.018))'. Together they form a unique fingerprint.

Cite this