Corrigendum to “TRPC3 channels critically regulate hippocampal excitability and contextual fear memory” (Behavioural Brain Research (2015) 281 (69–77) (S0166432814008122) (10.1016/j.bbr.2014.12.018))

The authors regret that numerical errors occurred in the 4th paragraph of the results section. Specifically, in the following sentences, where the corrections have been underlined: • (Fig. 3A: FC memory index; 55.6 ± 4.79% freezing, n = 7 mice)• …as well as naïve untrained controls (n = 7 mice)• [Fig. 3B: one-way ANOVA F(2,21) = 4.6, p = 0.02 (one-tailed) with post-hoc tests comparing FC relative to ISD (p = 0.004) and naïve cage controls (p = 0.05)]The authors have revised Fig. 3 caption to reflect these above changes; specifically, in the following sentences, where the corrections have been underlined: • (A) …(memory index; 55.6 ± 4.79% freezing, n = 7 mice)• (B) …(Cntl; n = 7 mice) and ISD controls [One-way ANOVA F(2,21) = 4.6, p = 0.02 with post-hoc tests comparing FC relative to ISD (p = 0.004) and naïve cage controls (p = 0.05)]• Additionally, the authors have revised the corresponding figure (Fig. 3A & B) to reflect these changes.In addition, a nucleotide was omitted from the sequence of mTrpC3 shRNA in the methods section of the manuscript. The sequence of mTrpC3 shRNA is GAGGUUCAAUAUUUCACCUAUGC The authors would like to apologise for any inconvenience caused.